Deployment Reference¶
This reference is for platform maintainers, administrators, and developers who need the details behind the quick-start deployment path.
TL;DR
Single source of truth for Bicep modules under infra/, the azd
workflow, postprovision.sh template swap, network lockdown, AKS
sizing, redirect-URI setup, and cleanup. Use this when the
Get Started helper is not enough.
Researchers who only need to deploy and open the dashboard should start with Get Started.
Deployment Shape¶
The production target is one Azure Container App with six sidecars: frontend, api, worker, beat, redis, and terminal. The browser is the primary user interface after deployment. Local commands are for installing tools, deploying the control plane, and validating the first environment.
Image builds run in Azure Container Registry with az acr build; Docker is not required for the normal deployment path.
Tool Installation¶
Minimum tools for deployment:
| Requirement | Needed for | Notes |
|---|---|---|
| Git | clone | Use the WSL package on Windows. |
| Bash | helper scripts | Native on Linux/macOS; use WSL on Windows. |
| Azure CLI | Azure login and deployment hooks | Command: az; use 2.81 or newer. |
| Azure Developer CLI | azd up deployment |
Command: azd; use 1.10 or newer. |
| jq | setup scripts | Used by App Registration and validation scripts. |
| curl | installers and smoke checks | Usually already present on Linux/macOS. |
Development and validation also use uv, Python 3.12, Node.js 20, npm, and optional Docker.
Windows With WSL2¶
Run from PowerShell as an administrator:
Then run project commands inside Ubuntu:
sudo apt-get update
sudo apt-get install -y git curl jq unzip ca-certificates gnupg lsb-release
curl -sL https://aka.ms/InstallAzureCLIDeb | sudo bash
curl -fsSL https://aka.ms/install-azd.sh | bash
exec $SHELL -l
Clone inside the WSL Linux filesystem, for example under ~/dev, not under /mnt/c/....
macOS¶
Using Homebrew:
Ubuntu Or Debian¶
sudo apt-get update
sudo apt-get install -y git curl jq unzip ca-certificates gnupg lsb-release
curl -sL https://aka.ms/InstallAzureCLIDeb | sudo bash
curl -fsSL https://aka.ms/install-azd.sh | bash
exec $SHELL -l
Clone And Check Tools¶
mkdir -p ~/dev
cd ~/dev
git clone https://github.com/dotnetpower/elb-dashboard.git
cd elb-dashboard
az --version | head -1
azd version
jq --version
git --version
For development machines, also install and verify the pinned runtime stacks:
curl -LsSf https://astral.sh/uv/install.sh | sh
uv python install 3.12
uv sync --all-groups
cd web
npm ci
cd ..
One-Command Deployment¶
The recommended deployment entry point is still:
Useful environment overrides:
export AZD_ENV_NAME=elb-dashboard
export AZURE_LOCATION=koreacentral
export LOCKDOWN_PRIVATE_NETWORKING=false
export ALLOWED_ORIGINS=""
export ELB_EXISTING_RG_ACTION=number # delete, number, or abort
export ELB_AUTO_FIX_RBAC=true # let post-deploy doctor grant missing roles
export ELB_BOOTSTRAP_CLUSTER_RG=true # pre-create rg-elb-cluster + grant MI roles
export ELB_CLUSTER_RG_NAME=rg-elb-cluster
./deploy.sh
See Get Started → Environment Overrides for the complete table.
Prepare only, without running azd up:
Manual azd Path¶
Use this path only when you need to control each value yourself.
az login
az account set --subscription "<your-subscription-name-or-id>"
azd auth login --use-device-code --tenant-id "$(az account show --query tenantId -o tsv)"
azd env new elb-dashboard
azd env set AZURE_LOCATION koreacentral
azd env set ALLOWED_ORIGINS ""
azd env set LOCKDOWN_PRIVATE_NETWORKING false
scripts/dev/preflight-check.sh
azd up
Leave DEPLOYER_PRINCIPAL_ID unset unless your administrator explicitly gives you a principal object id to use.
What azd up Does¶
./deploy.sh prints an azd up progress map before long-running work starts, then marks the active step as [n/8] while it runs (steps 0/8 through 8/8, nine phases in total).
| Step | Title | What runs |
|---|---|---|
| 0/8 | Local bootstrap | az / azd sign-in check, azd env target check (3-way prompt on mismatch unless ELB_ALLOW_AZD_ENV_RETARGET=true), azd env create/select, env-value upsert, caller permission pre-check (_caller-precheck.sh). |
| ⅛ | Provider registration | scripts/dev/register-providers.sh registers the providers Bicep requires. |
| 2/8 | Resource group choice | scripts/dev/resolve-resource-group.sh reuses rg-elb-dashboard or picks the next numbered slot (rg-elb-dashboard-NN), honoring ELB_EXISTING_RG_ACTION / ELB_RESOURCE_NAME_SLOT. |
| ⅜ | Bicep provision | azd up deploys infra/main.bicep (RG, VNet, MI, ACR, Storage, Key Vault, Container Apps Environment, bootstrap Container App). |
| 4/8 | App registration | Creates or reuses the SPA/API App Registration; skipped when API_CLIENT_ID is set. |
| ⅝ | Resource validation | Verifies Storage HNS and the dashboard discovery tags (azd-env-name, app, topology, …). |
| 6/8 | Image builds | az acr build for api, frontend, and terminal directly in ACR — no local Docker required. |
| ⅞ | Sidecar swap | scripts/dev/postprovision.sh applies the six-sidecar template to ca-elb-dashboard (frontend, api, worker, beat, redis, terminal) with min=max=1. |
| 8/8 | Health check | Polls /api/health until 200 OK, prints the Container App URL, and tries to open it in the browser. |
After step 8/8, deploy.sh runs three follow-up helpers (see Get Started → Post-deploy):
scripts/dev/grant-local-rbac.sh— local-debug Storage / ACR roles for the deployer (skip withELB_SKIP_LOCAL_RBAC=true).scripts/dev/check-mi-rbac.sh --auto-fix— managed-identity RBAC doctor (read-only withELB_AUTO_FIX_RBAC=false).scripts/dev/grant-runtime-rbac.sh— pre-creates the cluster RG (defaultrg-elb-cluster) and grants the MIContributor + UAAon it so the first Create Cluster click works (disable withELB_BOOTSTRAP_CLUSTER_RG=false).
Check the health endpoint:
APP_URL=$(azd env get-values | awk -F= '/^CONTAINER_APP_URL=/{gsub(/"/,"",$2); print $2}')
curl -fsS "$APP_URL/api/health" | python -m json.tool
Confirm the sidecar layout:
AZURE_RESOURCE_GROUP=$(azd env get-values | awk -F= '/^AZURE_RESOURCE_GROUP=/{gsub(/"/,"",$2); print $2}')
az containerapp show \
--resource-group "$AZURE_RESOURCE_GROUP" \
--name ca-elb-dashboard \
--query 'properties.template.containers[].name' \
-o table
Expected containers: frontend, api, worker, beat, redis, and terminal.
Redirect URI After Deployment¶
The setup script creates the local redirect URI http://localhost:8090. After azd up prints the real Container App URL, add that origin as an additional SPA redirect URI if the helper did not already persist it.
API_CLIENT_ID=$(azd env get-values | awk -F= '/^API_CLIENT_ID=/{gsub(/"/,"",$2); print $2}')
APP_URL=$(azd env get-values | awk -F= '/^CONTAINER_APP_URL=/{gsub(/"/,"",$2); print $2}')
APP_OBJECT_ID=$(az ad app show --id "$API_CLIENT_ID" --query id -o tsv)
REDIRECTS=$(az rest \
--method GET \
--uri "https://graph.microsoft.com/v1.0/applications/$APP_OBJECT_ID?\$select=spa" \
| jq -c --arg uri "$APP_URL" '(.spa.redirectUris // []) + [$uri] | unique')
az rest \
--method PATCH \
--uri "https://graph.microsoft.com/v1.0/applications/$APP_OBJECT_ID" \
--headers "Content-Type=application/json" \
--body "{\"spa\":{\"redirectUris\":$REDIRECTS}}"
Keep http://localhost:8090 if you also use the local web app.
Optional BLAST Smoke Test¶
Run this only in tenants where AKS is allowed to remain running long enough for the job lifecycle.
First-run values:
| Setting | Value |
|---|---|
| AKS cluster name | elb-smoke-aks |
| AKS system pool | Standard_D2s_v3, 1 node |
| AKS BLAST workload pool | Standard_D8s_v3, 1 node |
| BLAST database | 16S_ribosomal_RNA |
| Program | blastn |
| Output format | 5 (XML) |
| Sharding mode | Off |
| Warmup | Off for the first smoke run |
Browser path:
- Build the ElasticBLAST runtime images from the ACR card.
- Download
16S_ribosomal_RNAfrom the Storage card. - Create
elb-smoke-aksfrom the AKS card. - Sign in inside the browser terminal with
az login --use-device-code. - Submit a tiny
blastnjob from New Search. - Open the result and confirm the XML contains
<BlastOutput>.
Required runtime image tags:
ncbi/elb:1.4.0ncbi/elasticblast-job-submit:4.1.0ncbi/elasticblast-query-split:0.1.4elb-openapi:4.14
Tiny query for the first smoke run:
>example_16S_rRNA Escherichia coli 16S ribosomal RNA partial sequence
AGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAAC
GGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTG
GGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCG
CAAGACCAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGC
TAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACC
AGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTG
CACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGT
AAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGA
The browser downloads results through the API sidecar. It should not receive a Storage SAS URL.
Network Lockdown¶
The steady-state posture is private networking: Storage, Key Vault, and ACR are reached by the Container App over private endpoints.
After the control plane and smoke test succeed:
After lockdown, local az storage blob list commands from a laptop may fail with network access errors. Use the dashboard/API path from inside the Container App for steady-state data access.
Cleanup¶
Stop the smoke AKS cluster:
AZURE_RESOURCE_GROUP=$(azd env get-values | awk -F= '/^AZURE_RESOURCE_GROUP=/{gsub(/"/,"",$2); print $2}')
az aks stop --resource-group "$AZURE_RESOURCE_GROUP" --name elb-smoke-aks
Delete only the smoke AKS cluster:
Remove the entire control plane:
Local Development Commands¶
uv run pytest -q api/tests
uv run ruff check api
cd web
npm run build
cd ..
scripts/dev/local-run.sh api
scripts/dev/local-run.sh web
scripts/dev/local-run.sh smoke
Optional local Redis, worker, and beat:
Clean Azure VM Validation¶
Use a clean Ubuntu 24.04 VM when you need to prove the guide from a fresh OS image. This is a maintainer validation path, not part of the deployed control-plane architecture.
Recommended VM size: Standard_D4s_v5.
Validation checkpoints:
- Tool versions print successfully.
uv sync --all-groupscreates the Python 3.12 environment.uv run pytest -q api/testspasses.cd web && npm run buildpasses.azd upfinishes successfully.curl "$APP_URL/api/health"returns HTTP200with"status":"ok".- The Container App revision lists the expected six sidecars.
Delete the validation VM resource group when finished.
Troubleshooting¶
If a script says Permission denied, make sure the executable bit survived the clone:
If a script prints $'\r': command not found, the checkout has Windows CRLF line endings. In WSL, set:
Then reclone the repository.
If azd up fails on a role assignment, confirm your account has Owner or User Access Administrator on the subscription. In restricted tenants, ask an Azure administrator to perform the role assignment step described in Auth.
If the deployed app signs in locally but not in Azure, confirm the deployed Container App origin was added as a SPA redirect URI in the App Registration.
If AKS provisioning succeeds but kubectl get storageclass azureblob-nfs-premium returns NotFound, enable the Blob CSI driver or reprovision the cluster with the dashboard's current AKS task.
If submit-jobs fails with missing /templates/volume-snapshot*.yaml or a VolumeSnapshot readiness error, rebuild ncbi/elasticblast-job-submit:4.1.0 from the dashboard ACR card.
If a manual terminal-side submit cannot write elastic-blast.log, pass an explicit writable path:
If the local dashboard shows access_denied or network_blocked against a deployed environment, grant your local az login user the local debugging roles:
To grant the same minimum role set to a different account (e.g. a teammate joining an existing deployment), pass --user:
Then wait 1-5 minutes for RBAC propagation.